circad | circRNAs associated with diseases

circRNA.37134
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gestational Diabetes Mellitus	ICD-10	Diabetes mellitus arising in pregnancy (O24.4)
DBLink	Link to database	PMID	29526755
Experimental Method
Sample Type	Placental Villi	Comparison	30 Gestational Diabetes Mellitus (GDM) cases and 30 normal controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCATGTCAGAGCTCCCATCT Reverse TTCTCGACCTGTCTGCCTTT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Yan, L, Feng, J, Cheng, F, Cui, X, Gao, L, Chen, Y, Wang, F, Zhong, T, Li, Y, Liu, L (2018). Circular RNA expression profiles in placental villi from women with gestational diabetes mellitus. Biochem. Biophys. Res. Commun., 498, 4:743-750.